Zbtb8osem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Zbtb8osem1(IMPC)J |
Name: |
zinc finger and BTB domain containing 8 opposite strand; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7519009 |
Gene: |
Zbtb8os Location: Chr4:129229325-129243664 bp, + strand Genetic Position: Chr4, 63.26 cM, cytoband D2.3
|
Alliance: |
Zbtb8osem1(IMPC)J page
|
IMPC: |
Zbtb8os gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATTTACAAACATCCTATAT and GTTGAGTTATATAATTTACA, which resulted in a 671 bp deletion beginning at Chromosome 4 position 129,341,314 bp and ending after 129,341,984 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001231489 and ENSMUSE00001243208 (exons 3 and 4) and 466 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 1 amino acid later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|