Zbtb8os^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zbtb8os^em1(IMPC)J
• Name: zinc finger and BTB domain containing 8 opposite strand; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7519009
• Gene: Zbtb8os Location: Chr4:129229325-129243664 bp, + strand Genetic Position: Chr4, 63.26 cM, cytoband D2.3
• Alliance: Zbtb8os^em1(IMPC)J page
• IMPC: Zbtb8os gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATTTACAAACATCCTATAT and GTTGAGTTATATAATTTACA, which resulted in a 671 bp deletion beginning at Chromosome 4 position 129,341,314 bp and ending after 129,341,984 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001231489 and ENSMUSE00001243208 (exons 3 and 4) and 466 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zbtb8os Mutation: 48 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)