About   Help   FAQ
Rgs14em1Jorh
Endonuclease-mediated Allele Detail
Summary
Symbol: Rgs14em1Jorh
Name: regulator of G-protein signaling 14; endonuclease-mediated mutation 1, John R Hepler
MGI ID: MGI:7518842
Synonyms: RGS14 (L507R)
Gene: Rgs14  Location: Chr13:55517545-55532500 bp, + strand  Genetic Position: Chr13, 29.8 cM
Alliance: Rgs14em1Jorh page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsLeucine codon 507 (CTG) in exon 15 was changed to arginine (CGG) (p.L507R) using an sgRNA (targeting CTGGTGGAGCTGCTGAATCGGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.L505R variant in the nuclear export sequence (NES) of the encoded peptide, which blocks export of the protein from the nucleus. (J:338708)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rgs14 Mutation:  31 strains or lines available
References
Original:  J:338708 Squires KE, et al., Human genetic variants disrupt RGS14 nuclear shuttling and regulation of LTP in hippocampal neurons. J Biol Chem. 2021 Jan-Jun;296:100024
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory