Rgs14^em1Jorh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rgs14^em1Jorh
• Name: regulator of G-protein signaling 14; endonuclease-mediated mutation 1, John R Hepler
• MGI ID: MGI:7518842
• Synonyms: RGS14 (L507R)
• Gene: Rgs14 Location: Chr13:55517545-55532500 bp, + strand Genetic Position: Chr13, 29.8 cM
• Alliance: Rgs14^em1Jorh page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Leucine codon 507 (CTG) in exon 15 was changed to arginine (CGG) (p.L507R) using an sgRNA (targeting CTGGTGGAGCTGCTGAATCGGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.L505R variant in the nuclear export sequence (NES) of the encoded peptide, which blocks export of the protein from the nucleus. (J:338708)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rgs14 Mutation: 31 strains or lines available

References

• Original: J:338708 Squires KE, et al., Human genetic variants disrupt RGS14 nuclear shuttling and regulation of LTP in hippocampal neurons. J Biol Chem. 2021 Jan-Jun;296:100024
• All: 1 reference(s)