Tcf7^em1Aben
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tcf7^em1Aben
• Name: transcription factor 7, T cell specific; endonuclease-mediated mutation 1, Albert Bendelac
• MGI ID: MGI:7518204
• Synonyms: Tcf7^mCherry
• Gene: Tcf7 Location: Chr11:52143198-52174158 bp, - strand Genetic Position: Chr11, 31.86 cM
• Alliance: Tcf7^em1Aben page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Epitope tag, Reporter)
• Mutation: Insertion
• Mutation details: CRISPR/cas9 genome editing used a guide crRNA [CGACCTGAGAATGTTGGTGC] to insert an internal ribosomal entry site (IRES)/mCherry red fluorescent /3XFLAG epitope fusion gene into the 3' UTR of the gene. Tcf transcript Tcf-201 (ENSMUST00000086844.10) was used as reference for the exon number and guide sequences. (J:307783)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tcf7 Mutation: 29 strains or lines available

References

• Original: J:307783 Kasal DN, et al., Multi-transcription factor reporter mice delineate early precursors to the ILC and LTi lineages. J Exp Med. 2021 Feb 1;218(2)
• All: 1 reference(s)