About   Help   FAQ
Gata3em1Aben
Endonuclease-mediated Allele Detail
Summary
Symbol: Gata3em1Aben
Name: GATA binding protein 3; endonuclease-mediated mutation 1, Albert Bendelac
MGI ID: MGI:7518200
Synonyms: Gata3Citrine
Gene: Gata3  Location: Chr2:9861889-9894845 bp, - strand  Genetic Position: Chr2, 6.69 cM
Alliance: Gata3em1Aben page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Reporter)
Mutation:    Insertion
 
Mutation detailsCRISPR/cas9 genome editing used a guide crRNA [GGAGGAACTCTTCGCACACT] to insert an internal ribosomal entry site (IRES)/citrine yellow fluorescent sequence into the 3' UTR of the gene. Gata3 transcript Gata3-201 (ENSMUST00000102976.4) was used as reference for for the exon number and guide sequences (J:307783)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gata3 Mutation:  31 strains or lines available
References
Original:  J:307783 Kasal DN, et al., Multi-transcription factor reporter mice delineate early precursors to the ILC and LTi lineages. J Exp Med. 2021 Feb 1;218(2)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory