Wdr5em1Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Wdr5em1Tcp |
| Name: |
WD repeat domain 5; endonuclease-mediated mutation 1, The Centre for Phenogenomics |
| MGI ID: |
MGI:7516888 |
| Gene: |
Wdr5 Location: Chr2:27405169-27426547 bp, + strand Genetic Position: Chr2, 19.38 cM
|
| Alliance: |
Wdr5em1Tcp page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Conditional ready, No functional change) |
| Mutation: |
|
Insertion
|
| |
|
Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences TATTGCCCCTCTGCAGTGAA and GTGAGTGAGGTGAGATCCTA and two single-strand oligonucleotides encoding loxP sites. This resulted in loxP sites flanking four exons, ENSMUSE00001206138, ENSMUSE0000016411, ENSMUSE00000164106, and ENSMUSE00000164101 (GRCm39). The loxP sites are inserted after Chr2:27409637 and after Chr2:27411182. Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele.
(J:322048)
|
|
|
|
|
| Original: |
J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022; |
| All: |
1 reference(s) |
|