Wdr5^em1Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wdr5^em1Tcp
• Name: WD repeat domain 5; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7516888
• Gene: Wdr5 Location: Chr2:27405169-27426547 bp, + strand Genetic Position: Chr2, 19.38 cM
• Alliance: Wdr5^em1Tcp page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, No functional change)
• Mutation: Insertion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences TATTGCCCCTCTGCAGTGAA and GTGAGTGAGGTGAGATCCTA and two single-strand oligonucleotides encoding loxP sites. This resulted in loxP sites flanking four exons, ENSMUSE00001206138, ENSMUSE0000016411, ENSMUSE00000164106, and ENSMUSE00000164101 (GRCm39). The loxP sites are inserted after Chr2:27409637 and after Chr2:27411182. Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. (J:322048)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Wdr5 Mutation: 30 strains or lines available

References

• Original: J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022
• All: 1 reference(s)