Cd274^em1Bajt
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cd274^em1Bajt
• Name: CD274 antigen; endonuclease-mediated mutation 1, Beth A Jiron Tamburini
• MGI ID: MGI:7516359
• Synonyms: Pdl1^CyMt
• Gene: Cd274 Location: Chr19:29344855-29365495 bp, + strand Genetic Position: Chr19, 23.88 cM, cytoband C2
• Alliance: Cd274^em1Bajt page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Threonine codon 277 (ACA) and serine codons 278 (AGC) and 279 (TCA) were changed to alanine (GCTGCAGCC) using an sgRNA (targeting ACAAGCTCAAAAAACCGAAATGG) and an ssODN template with CRISPR/Cas9 technology. The mutation changes three phosphorylatable residues in the cytoplasmic tail of the encoded peptide to phosphoblockers, disrupting chemokine signaling in dendritic cells. (J:304322)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cd274 Mutation: 71 strains or lines available

References

• Original: J:304322 Lucas ED, et al., PD-L1 Reverse Signaling in Dermal Dendritic Cells Promotes Dendritic Cell Migration Required for Skin Immunity. Cell Rep. 2020 Oct 13;33(2):108258
• All: 1 reference(s)