About   Help   FAQ
Cd274em1Bajt
Endonuclease-mediated Allele Detail
Summary
Symbol: Cd274em1Bajt
Name: CD274 antigen; endonuclease-mediated mutation 1, Beth A Jiron Tamburini
MGI ID: MGI:7516359
Synonyms: Pdl1CyMt
Gene: Cd274  Location: Chr19:29344855-29365495 bp, + strand  Genetic Position: Chr19, 23.88 cM, cytoband C2
Alliance: Cd274em1Bajt page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsThreonine codon 277 (ACA) and serine codons 278 (AGC) and 279 (TCA) were changed to alanine (GCTGCAGCC) using an sgRNA (targeting ACAAGCTCAAAAAACCGAAATGG) and an ssODN template with CRISPR/Cas9 technology. The mutation changes three phosphorylatable residues in the cytoplasmic tail of the encoded peptide to phosphoblockers, disrupting chemokine signaling in dendritic cells. (J:304322)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Cd274 Mutation:  36 strains or lines available
References
Original:  J:304322 Lucas ED, et al., PD-L1 Reverse Signaling in Dermal Dendritic Cells Promotes Dendritic Cell Migration Required for Skin Immunity. Cell Rep. 2020 Oct 13;33(2):108258
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory