Ccnd3^em1Prad
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccnd3^em1Prad
• Name: cyclin D3; endonuclease-mediated mutation 1, Parham Ramezani-Rad
• MGI ID: MGI:7516123
• Synonyms: Ccnd3^T283A
• Gene: Ccnd3 Location: Chr17:47815976-47910614 bp, + strand Genetic Position: Chr17, 23.37 cM
• Alliance: Ccnd3^em1Prad page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Single point mutation
• Mutation details: Threonine codon 283 (ACT) in exon 7 was changed to alanine (GCT) (p.T283A) using an sgRNA (targeting GCTAGAGCCCCGGGGGGCTT) and an ssODN template with CRISPR/Cas9 technology. The mutation in the PEST domain of the encoded peptide, the equivalent of the human mutation associated with B cell non-Hodgkin lymphoma (B-NHL), replaces a phosphorylatable residue with a phosphoblocker and hyper-stabilizes the peptide. (J:304765)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ccnd3 Mutation: 507 strains or lines available

References

• Original: J:304765 Ramezani-Rad P, et al., Cyclin D3 Governs Clonal Expansion of Dark Zone Germinal Center B Cells. Cell Rep. 2020 Nov 17;33(7):108403
• All: 1 reference(s)