About   Help   FAQ
Ccnd3em1Prad
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccnd3em1Prad
Name: cyclin D3; endonuclease-mediated mutation 1, Parham Ramezani-Rad
MGI ID: MGI:7516123
Synonyms: Ccnd3T283A
Gene: Ccnd3  Location: Chr17:47815976-47910614 bp, + strand  Genetic Position: Chr17, 23.37 cM
Alliance: Ccnd3em1Prad page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Single point mutation
 
Mutation detailsThreonine codon 283 (ACT) in exon 7 was changed to alanine (GCT) (p.T283A) using an sgRNA (targeting GCTAGAGCCCCGGGGGGCTT) and an ssODN template with CRISPR/Cas9 technology. The mutation in the PEST domain of the encoded peptide, the equivalent of the human mutation associated with B cell non-Hodgkin lymphoma (B-NHL), replaces a phosphorylatable residue with a phosphoblocker and hyper-stabilizes the peptide. (J:304765)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ccnd3 Mutation:  507 strains or lines available
References
Original:  J:304765 Ramezani-Rad P, et al., Cyclin D3 Governs Clonal Expansion of Dark Zone Germinal Center B Cells. Cell Rep. 2020 Nov 17;33(7):108403
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory