Nwd1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nwd1^em1(IMPC)J
• Name: NACHT and WD repeat domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7515017
• Gene: Nwd1 Location: Chr8:73372865-73443508 bp, + strand Genetic Position: Chr8, 35.08 cM
• Alliance: Nwd1^em1(IMPC)J page
• IMPC: Nwd1 gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTGTAATAGTCACACCATC and ACTTGCGTTTGAGATCACAG, which resulted in a 546 bp deletion beginning at Chromosome 8 position 72,662,018 bp and ending after 72,662,563 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000981978 (exon 4) and 248 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 69 and early truncation 8 amino acids later. There is a 4 bp insertion at the deletion site (TTGA). (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nwd1 Mutation: 73 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)