About   Help   FAQ
Dimt1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dimt1em1(IMPC)J
Name: DIM1 rRNA methyltransferase and ribosome maturation factor; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7515012
Gene: Dimt1  Location: Chr13:107083635-107096732 bp, + strand  Genetic Position: Chr13, 58.06 cM, cytoband D1
Alliance: Dimt1em1(IMPC)J page
IMPC: Dimt1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGCAATCGGTTCTACTGGT and TTCTGGCAAGAAACACAGGG, which resulted in a 1536 bp deletion beginning at Chromosome 13 position 106,948,451 bp and ending after 106,949,986 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000120073, ENSMUSE00000120072, ENSMUSE00000120070, ENSMUSE00000311714 (exons 3,4,5 and 6) and 1243 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 51 and early truncation 20 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dimt1 Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/21/2024
MGI 6.23
The Jackson Laboratory