Dhrs7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dhrs7^em1(IMPC)J
• Name: dehydrogenase/reductase 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7515007
• Gene: Dhrs7 Location: Chr12:72697127-72711678 bp, - strand Genetic Position: Chr12, 30.23 cM
• Alliance: Dhrs7^em1(IMPC)J page
• IMPC: Dhrs7 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCTCATCCTTACATCCCCA and TCTACCCCACAAAAAGGTGG, which resulted in a 1560 bp deletion beginning at Chromosome 12 position 72,656,058 bp and ending after 72,657,617 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000299539 and ENSMUSE00000114560 (exons 3 and 4) and 1213 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 95 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dhrs7 Mutation: 39 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)