Phf12em1.1Tcp
Endonuclease-mediated Allele Detail
|
Symbol: |
Phf12em1.1Tcp |
Name: |
PHD finger protein 12; endonuclease-mediated mutation 1.1, The Centre for Phenogenomics |
MGI ID: |
MGI:7513993 |
Gene: |
Phf12 Location: Chr11:77873580-77921365 bp, + strand Genetic Position: Chr11, 46.74 cM, cytoband B5
|
Alliance: |
Phf12em1.1Tcp page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences TTAGGCGCATACACAGCGCA and AACCTTTGATGCGCTTCTCC and two single-strand oligonucleotides encoding loxP sites. This inserted loxP sites after Chr11:77900073 and Chr11:7790072, flanking exon ENSMUSE00000339213. An additional sequence was inserted after the proximal (5') loxP site after Chr11:77900077 corresponding to a duplication of Chr11:77900015 to 77900047 in reverse orientation. Cre excised to remove the critical region, leaving behind a loxP site.
(J:322048)
|
|
|
|
Original: |
J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022; |
All: |
1 reference(s) |
|