Phf12^em1Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Phf12^em1Tcp
• Name: PHD finger protein 12; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7513990
• Gene: Phf12 Location: Chr11:77873580-77921365 bp, + strand Genetic Position: Chr11, 46.74 cM, cytoband B5
• Alliance: Phf12^em1Tcp page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, No functional change)
• Mutation: Insertion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences TTAGGCGCATACACAGCGCA and AACCTTTGATGCGCTTCTCC and two single-strand oligonucleotides encoding loxP sites. This inserted loxP sites after Chr11:77900073 and Chr11:7790072, flanking exon ENSMUSE00000339213. An additional sequence was inserted after the proximal (5') loxP site after Chr11:77900077 corresponding to a duplication of Chr11:77900015 to 77900047 in reverse orientation. (J:322048)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Phf12 Mutation: 47 strains or lines available

References

• Original: J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022
• All: 1 reference(s)