About   Help   FAQ
Phf12em1Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Phf12em1Tcp
Name: PHD finger protein 12; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:7513990
Gene: Phf12  Location: Chr11:77873580-77921365 bp, + strand  Genetic Position: Chr11, 46.74 cM, cytoband B5
Alliance: Phf12em1Tcp page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, No functional change)
Mutation:    Insertion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences TTAGGCGCATACACAGCGCA and AACCTTTGATGCGCTTCTCC and two single-strand oligonucleotides encoding loxP sites. This inserted loxP sites after Chr11:77900073 and Chr11:7790072, flanking exon ENSMUSE00000339213. An additional sequence was inserted after the proximal (5') loxP site after Chr11:77900077 corresponding to a duplication of Chr11:77900015 to 77900047 in reverse orientation. (J:322048)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Phf12 Mutation:  48 strains or lines available
References
Original:  J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory