About   Help   FAQ
Phf12em1Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Phf12em1Tcp
Name: PHD finger protein 12; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:7513990
Gene: Phf12  Location: Chr11:77873580-77921365 bp, + strand  Genetic Position: Chr11, 46.74 cM, cytoband B5
Alliance: Phf12em1Tcp page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, No functional change)
Mutation:    Insertion
 
Mutation details:  This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences AACCTTTGATGCGCTTCTCC and TTAGGCGCATACACAGCGCA. This resulted in insertions of 48 bp (location: chr11:77900073; GRCm39), 50 bp (location: chr11:77900721; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Phf12 Mutation:  48 strains or lines available
References
Original:  J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory