About   Help   FAQ
Pcbp3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pcbp3em1(IMPC)J
Name: poly(rC) binding protein 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7513904
Gene: Pcbp3  Location: Chr10:76597691-76797721 bp, - strand  Genetic Position: Chr10, 39.72 cM, cytoband B5.1-B5.3
Alliance: Pcbp3em1(IMPC)J page
IMPC: Pcbp3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGTTCCAGTGATACCCGCA and TGTGTTTTCCACGGGCCATA, which resulted in a 2657 bp deletion beginning at Chromosome 10 position 76,767,806 bp and ending after 76,770,462 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001244493 and ENSMUSE00001226971 (exons 13 and 14) and 2544 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 264 and early truncation 15 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pcbp3 Mutation:  21 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory