Pah^em1Auma
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pah^em1Auma
• Name: phenylalanine hydroxylase; endonuclease-mediated mutation 1, Aurora Martinez
• MGI ID: MGI:7512826
• Synonyms: Pah-R261Q
• Gene: Pah Location: Chr10:87357657-87419998 bp, + strand Genetic Position: Chr10, 43.64 cM, cytoband C2-D1
• Alliance: Pah^em1Auma page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Arginine codon 261 (CGA) in exon 7 was changed to glutamine (CAA) (c.782 G>A, p.R261Q) using an sgRNA (targeting AGTGGAAGACTCGGAAGGCCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation mimics the same human mutation associated with phenylketonuria (PKU). (J:305268)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pah Mutation: 53 strains or lines available

References

• Original: J:305268 Aubi O, et al., The Pah-R261Q mouse reveals oxidative stress associated with amyloid-like hepatic aggregation of mutant phenylalanine hydroxylase. Nat Commun. 2021 Apr 6;12(1):2073
• All: 1 reference(s)