Lrp4^em1Alegr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lrp4^em1Alegr
• Name: low density lipoprotein receptor-related protein 4; endonuclease-mediated mutation 1, Alexander G Robling
• MGI ID: MGI:7512774
• Synonyms: Lrp4^KI, Lrp4 R1170W
• Gene: Lrp4 Location: Chr2:91287856-91344124 bp, + strand Genetic Position: Chr2, 50.63 cM
• Alliance: Lrp4^em1Alegr page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Arginine codon 1170 (CGG) in exon 25 was changed to tryptophan (TGG) (c.3508C>T, p.R1170W) using an sgRNA (targeting CCCCGGGCCATTGTATTATACCAT) and an ssODN template with CRISPR/Cas9 technology. This mutation mimics a human mutation associated with a sclerosteosislike phenotype. (J:305286)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Lrp4 Mutation: 96 strains or lines available

References

• Original: J:305286 Bullock WA, et al., Lrp4 Mediates Bone Homeostasis and Mechanotransduction through Interaction with Sclerostin In Vivo. iScience. 2019 Oct 25;20:205-215
• All: 1 reference(s)