About   Help   FAQ
Lrp4em1Alegr
Endonuclease-mediated Allele Detail
Summary
Symbol: Lrp4em1Alegr
Name: low density lipoprotein receptor-related protein 4; endonuclease-mediated mutation 1, Alexander G Robling
MGI ID: MGI:7512774
Synonyms: Lrp4KI, Lrp4 R1170W
Gene: Lrp4  Location: Chr2:91287856-91344124 bp, + strand  Genetic Position: Chr2, 50.63 cM
Alliance: Lrp4em1Alegr page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsArginine codon 1170 (CGG) in exon 25 was changed to tryptophan (TGG) (c.3508C>T, p.R1170W) using an sgRNA (targeting CCCCGGGCCATTGTATTATACCAT) and an ssODN template with CRISPR/Cas9 technology. This mutation mimics a human mutation associated with a sclerosteosislike phenotype. (J:305286)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Lrp4 Mutation:  96 strains or lines available
References
Original:  J:305286 Bullock WA, et al., Lrp4 Mediates Bone Homeostasis and Mechanotransduction through Interaction with Sclerostin In Vivo. iScience. 2019 Oct 25;20:205-215
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory