Mc4r^em1Mrub
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mc4r^em1Mrub
• Name: melanocortin 4 receptor; endonuclease-mediated mutation 1, Marcelo Rubinstein
• MGI ID: MGI:7511843
• Synonyms: Mc4r^V103I
• Gene: Mc4r Location: Chr18:66990776-66993558 bp, - strand Genetic Position: Chr18, 39.72 cM, cytoband E1
• Alliance: Mc4r^em1Mrub page

Mutation origin

• Strain of Origin: FVB/NJ

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Valine codon 103 (GTC) in exon 1 was changed to isoleucine (ATC) (p.V103I) using an sgRNA (CCGUAUCCGUACUGUUUAAC) and an ssODN template with CRISPR/Cas9 technology. This mutation mimics the same human variant associated with protection against obesity and increased adiposity in people of European descent. (J:305517)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mc4r Mutation: 44 strains or lines available

References

• Original: J:305517 Rojo D, et al., Mouse models for V103I and I251L gain of function variants of the human MC4R display decreased adiposity but are not protected against a hypercaloric diet. Mol Metab. 2020 Dec;42:101077
• All: 1 reference(s)