Rapsn^em1Line
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rapsn^em1Line
• Name: receptor-associated protein of the synapse; endonuclease-mediated mutation 1, Lin Mei
• MGI ID: MGI:7511609
• Synonyms: Rapsn R164H
• Gene: Rapsn Location: Chr2:90865965-90876074 bp, + strand Genetic Position: Chr2, 50.44 cM
• Alliance: Rapsn^em1Line page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codon 164 (CGT) in exon 2 was changed to histidine (CAC) (p.R164H) using an sgRNA (targeting TGCCCAGGCTGCAGCAGACA) and an ssODN template with CRISPR/Cas9 technology. This mutation in the fifth TRP motif inhibits Rapsn LLPS (liquid-liquid phase separation). (J:307397)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rapsn Mutation: 31 strains or lines available

References

• Original: J:307397 Xing G, et al., Membraneless condensates by Rapsn phase separation as a platform for neuromuscular junction formation. Neuron. 2021 Jun 16;109(12):1963-1978.e5
• All: 1 reference(s)