Naalad2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Naalad2^em1(IMPC)J
• Name: N-acetylated alpha-linked acidic dipeptidase 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7510099
• Gene: Naalad2 Location: Chr9:18233247-18308834 bp, - strand Genetic Position: Chr9, 7.02 cM, cytoband A3
• Alliance: Naalad2^em1(IMPC)J page
• IMPC: Naalad2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATTCTAAGGCTACTTGACT and GACATAGAAAAAATCTTACC, which resulted in a 514 bp deletion beginning at Chromosome 9 position 18,380,551 bp and ending after 18,381,064 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000367700 (exon 3) and 354 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 65 and early truncation 50 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Naalad2 Mutation: 45 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)