Carhsp1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Carhsp1^em1(IMPC)J
• Name: calcium regulated heat stable protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7507543
• Gene: Carhsp1 Location: Chr16:8476444-8490017 bp, - strand Genetic Position: Chr16, 4.26 cM
• Alliance: Carhsp1^em1(IMPC)J page
• IMPC: Carhsp1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTATGTCCACCACAGATGGT and ACAGAGCTTGAGACTCCTAG, which resulted in a 1108 bp deletion beginning at Chromosome 16 position 8,663,387 bp and ending after 8,664,494 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000129745 and ENSMUSE00000563877 (exons 2 and 3) and 797 bp of flanking intronic sequence including the splice acceptor and donor as well as start site and is predicted result in a null allele. There is a 9 bp insertion (TCACTCACA)at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Carhsp1 Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)