Ripk1^em4Xlin
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ripk1^em4Xlin
• Name: receptor (TNFRSF)-interacting serine-threonine kinase 1; endonuclease-mediated mutation 4, Xin Lin
• MGI ID: MGI:7507082
• Synonyms: Ripk1^K612R
• Gene: Ripk1 Location: Chr13:34186346-34221130 bp, + strand Genetic Position: Chr13, 14.01 cM
• Alliance: Ripk1^em4Xlin page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: Lysine codon 612 (AAA) in exon 11 was changed to arginine (AGG) (p.K612R) using an sgRNA (targeting AATGCTTCAGAAGTGGCTGA) and an ssODN template with CRISPR/Cas9 technology. This mutation prevents linear ubiquination of the residue in the encoded peptide. (J:308019)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ripk1 Mutation: 32 strains or lines available

References

• Original: J:308019 Tu H, et al., Linear Ubiquitination of RIPK1 on Lys 612 Regulates Systemic Inflammation via Preventing Cell Death. J Immunol. 2021 Jun 23;207(2):602-612
• All: 1 reference(s)