About   Help   FAQ
Tbx5em1Vmc
Endonuclease-mediated Allele Detail
Summary
Symbol: Tbx5em1Vmc
Name: T-box 5; endonuclease-mediated mutation 1, Vincent M Christoffels
MGI ID: MGI:7491981
Synonyms: Tbx5G125R
Gene: Tbx5  Location: Chr5:119970733-120023284 bp, + strand  Genetic Position: Chr5, 60.42 cM
Alliance: Tbx5em1Vmc page
Mutation
origin
Strain of Origin:  FVB
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsGlycine codon 125 (GGC) was changed to arginine (CGC) (p.G125R) using sgRNAs (targeting TAGGCCTTCATGTAGGTCCGTAAC and AAACGTTACGGACCTACATGAAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with HoltOram syndrome (HOS) or handheart syndrome. (J:333401)
Expression
In Mice Carrying this Mutation: 2 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tbx5 Mutation:  30 strains or lines available
References
Original:  J:333401 van Ouwerkerk AF, et al., Patient-Specific TBX5-G125R Variant Induces Profound Transcriptional Deregulation and Atrial Dysfunction. Circulation. 2022 Feb 22;145(8):606-619
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory