Tbx5^em1Vmc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tbx5^em1Vmc
• Name: T-box 5; endonuclease-mediated mutation 1, Vincent M Christoffels
• MGI ID: MGI:7491981
• Synonyms: Tbx5^G125R
• Gene: Tbx5 Location: Chr5:119970733-120023284 bp, + strand Genetic Position: Chr5, 60.42 cM
• Alliance: Tbx5^em1Vmc page

Mutation origin

• Strain of Origin: FVB

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Glycine codon 125 (GGC) was changed to arginine (CGC) (p.G125R) using sgRNAs (targeting TAGGCCTTCATGTAGGTCCGTAAC and AAACGTTACGGACCTACATGAAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with HoltOram syndrome (HOS) or handheart syndrome. (J:333401)

Expression

In Mice Carrying this Mutation:

2 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tbx5 Mutation: 30 strains or lines available

References

• Original: J:333401 van Ouwerkerk AF, et al., Patient-Specific TBX5-G125R Variant Induces Profound Transcriptional Deregulation and Atrial Dysfunction. Circulation. 2022 Feb 22;145(8):606-619
• All: 1 reference(s)