Fer1l6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fer1l6^em1(IMPC)J
• Name: fer-1 like family member 6; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7491739
• Gene: Fer1l6 Location: Chr15:58381897-58536936 bp, + strand Genetic Position: Chr15, 24.88 cM
• Alliance: Fer1l6^em1(IMPC)J page
• IMPC: Fer1l6 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTTCACCAGAGATGTAGAG and AGGAGAAGAGCGTAGCCACT, which resulted in a 635 bp deletion beginning at Chromosome 15 position 58,549,969 bp and ending after 58,550,603 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000851953 and ENSMUSE00000870098 (exons 4-5) and 448 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 64 and early truncation 27 amino acids later. There is a single bp insertion (T) at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fer1l6 Mutation: 89 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)