Gm13889^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gm13889^em1(IMPC)J
• Name: predicted gene 13889; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7491695
• Gene: Gm13889 Location: Chr2:93786155-93787445 bp, - strand Genetic Position: Chr2, 51.62 cM
• Alliance: Gm13889^em1(IMPC)J page
• IMPC: Gm13889 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGGGCCGAGTCGGAGTCGC and CATCCGAGCTTGCAGCCGTG, which resulted in a 707 bp deletion beginning at Chromosome 2 position 93,956,403 bp and ending after 93,957,109 bp (GRCm38/mm10). This mutation deletes 707 bp from ENSMUSE00000643086 (exon 1) and is predicted to cause a change of amino acid sequence after residue 7 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gm13889 Mutation: 7 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)