About   Help   FAQ
Ccdc27em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc27em1(IMPC)J
Name: coiled-coil domain containing 27; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7490402
Gene: Ccdc27  Location: Chr4:154111096-154127134 bp, - strand  Genetic Position: Chr4, 83.79 cM
Alliance: Ccdc27em1(IMPC)J page
IMPC: Ccdc27 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGGGTGTCTAGATAGCTG and CTTCTGATGGAGGGTTGGGA, which resulted in a 757 bp deletion beginning at Chromosome 4 position 154,039,447 bp and ending after 154,040,203 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000332415 (exon 4) and 602 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 140 and early truncation 63 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ccdc27 Mutation:  31 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/21/2024
MGI 6.23
The Jackson Laboratory