Art5^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Art5^em1(IMPC)J
• Name: ADP-ribosyltransferase 5; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7490376
• Gene: Art5 Location: Chr7:101746086-101752052 bp, - strand Genetic Position: Chr7, 54.71 cM
• Alliance: Art5^em1(IMPC)J page
• IMPC: Art5 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCGCTGTTCCTTGGTCTACG and ACATAGCTGATGCATGCAAT, which resulted in a 1029 bp deletion beginning at Chromosome 7 position 102,097,590 bp and ending after 102,098,618 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000589867 (exon 3) and 299 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 20 and early truncation 64 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Art5 Mutation: 34 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)