Atp6ap2em1Tiy
Endonuclease-mediated Allele Detail
|
Symbol: |
Atp6ap2em1Tiy |
Name: |
ATPase, H+ transporting, lysosomal accessory protein 2; endonuclease-mediated mutation 1, Tianxin Yang |
MGI ID: |
MGI:7490239 |
Synonyms: |
PRRR279V/L282V |
Gene: |
Atp6ap2 Location: ChrX:12454040-12483288 bp, + strand Genetic Position: ChrX, 7.42 cM
|
Alliance: |
Atp6ap2em1Tiy page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Not Specified) |
Mutation: |
|
Nucleotide substitutions
|
|
|
Mutation details: Arginine codon 279 (AGG) and leucine codon 282 (CTT) in exon 8 were changed to valine (GTG, GTT) (p.R279V, p.L282V) using an sgRNA (targeting GAAGTCAAGGACCATCCTTGAGG) and ssODN template with CRISPR/Cas9 technology. These mutations block processing of the encoded peptide by FURIN (paired basic amino acid cleaving enzyme) and site 1 membrane-bound transcription factor peptidase (MBTPS1).
(J:324586)
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Atp6ap2 Mutation: |
9 strains or lines available
|
|
Original: |
J:324586 Wang F, et al., Mutagenesis of the Cleavage Site of Pro Renin Receptor Abrogates Angiotensin II-Induced Hypertension in Mice. Hypertension. 2021 Jul;78(1):115-127 |
All: |
1 reference(s) |
|