Atp6ap2^em1Tiy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Atp6ap2^em1Tiy
• Name: ATPase, H+ transporting, lysosomal accessory protein 2; endonuclease-mediated mutation 1, Tianxin Yang
• MGI ID: MGI:7490239
• Synonyms: PRR^R279V/L282V
• Gene: Atp6ap2 Location: ChrX:12454040-12483288 bp, + strand Genetic Position: ChrX, 7.42 cM
• Alliance: Atp6ap2^em1Tiy page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codon 279 (AGG) and leucine codon 282 (CTT) in exon 8 were changed to valine (GTG, GTT) (p.R279V, p.L282V) using an sgRNA (targeting GAAGTCAAGGACCATCCTTGAGG) and ssODN template with CRISPR/Cas9 technology. These mutations block processing of the encoded peptide by FURIN (paired basic amino acid cleaving enzyme) and site 1 membrane-bound transcription factor peptidase (MBTPS1). (J:324586)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Atp6ap2 Mutation: 10 strains or lines available

References

• Original: J:324586 Wang F, et al., Mutagenesis of the Cleavage Site of Pro Renin Receptor Abrogates Angiotensin II-Induced Hypertension in Mice. Hypertension. 2021 Jul;78(1):115-127
• All: 1 reference(s)