Flt3^tm1.1Dgg
Targeted Allele Detail

Summary

• Symbol: Flt3^tm1.1Dgg
• Name: FMS-like tyrosine kinase 3; targeted mutation 1.1, D Gilliland
• MGI ID: MGI:7489690
• Synonyms: Flt^ITDdelta
• Gene: Flt3 Location: Chr5:147267551-147337299 bp, - strand Genetic Position: Chr5, 86.88 cM, cytoband G3
• Alliance: Flt3^tm1.1Dgg page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:336420
• Parent Cell Line: R1 (ES Cell)
• Strain of Origin: (129X1/SvJ x 129S1/Sv)F1-Kitl⁺

Mutation description

• Allele Type: Targeted (Humanized sequence)
• Mutations: Insertion, Intragenic deletion
• Mutation details: The human W51 mutation which causes the duplication of amino acid 595 to 601 (REYEYDL; AGAGAATATGAATATGATCTC) was inserted in-frame into exon 14, replacing the endogenous single copy (RDYEYDL; AGGGACTATGAATATGACCTT). A loxP site flanked neomycin selection cassette was inserted into intron 15, then was removed via Cre-mediated recombination in the germline. (J:336420)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Flt3 Mutation: 94 strains or lines available

References

• Original: J:336420 Li Y, et al., FLT3ITD drives context-specific changes in cell identity and variable interferon dependence during AML initiation. Blood. 2023 Mar 23;141(12):1442-1456
• All: 1 reference(s)