Rr108735^em1Axvi
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr108735^em1Axvi
• Name: regulatory region 108735; endonuclease-mediated mutation 1, Axel Visel
• MGI ID: MGI:7489687
• Synonyms: CTCF delta
• Gene: Rr108735 Location: Chr5:120240201-120241600 bp Genetic Position: Chr5, Syntenic
• Alliance: Rr108735^em1Axvi page

Mutation origin

• Strain of Origin: FVB

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: CTCF-binding sequence downstream of Tbx5 lung enhancer Rr426, located downstream of the gene, was targeted with sgRNAs (targeting GCATGCTGGGGTAAGCCCGAGGG and GCTGGGGTGCCAAGCCCAGAGGG, GGTCAGAGTCTGCCGCCCAAAGG and AAGGCCTGAGAGCGCGCCAGTGG) using CRISPR/Cas9 technology, resulting in an 1135 bp deletion (chr5:120240528-120241662 (GRCm39)). (J:335096)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr108735 Mutation: 0 strains or lines available

References

• Original: J:335096 Rajderkar S, et al., Topologically associating domain boundaries are required for normal genome function. Commun Biol. 2023 Apr 20;6(1):435
• All: 1 reference(s)