Rr108735em1Axvi
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr108735em1Axvi |
| Name: |
regulatory region 108735; endonuclease-mediated mutation 1, Axel Visel |
| MGI ID: |
MGI:7489687 |
| Synonyms: |
CTCF delta |
| Gene: |
Rr108735 Location: Chr5:120240201-120241600 bp Genetic Position: Chr5, Syntenic
|
| Alliance: |
Rr108735em1Axvi page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Intergenic deletion
|
| |
|
Mutation details: CTCF-binding sequence downstream of Tbx5 lung enhancer Rr426, located downstream of the gene, was targeted with sgRNAs (targeting GCATGCTGGGGTAAGCCCGAGGG and GCTGGGGTGCCAAGCCCAGAGGG, GGTCAGAGTCTGCCGCCCAAAGG and AAGGCCTGAGAGCGCGCCAGTGG) using CRISPR/Cas9 technology, resulting in an 1135 bp deletion (chr5:120240528-120241662 (GRCm39)).
(J:335096)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr108735 Mutation: |
0 strains or lines available
|
|
| Original: |
J:335096 Rajderkar S, et al., Topologically associating domain boundaries are required for normal genome function. Commun Biol. 2023 Apr 20;6(1):435 |
| All: |
1 reference(s) |
|