About   Help   FAQ
Rr108735em1Axvi
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr108735em1Axvi
Name: regulatory region 108735; endonuclease-mediated mutation 1, Axel Visel
MGI ID: MGI:7489687
Synonyms: CTCF delta
Gene: Rr108735  Location: Chr5:120240201-120241600 bp  Genetic Position: Chr5, Syntenic
Alliance: Rr108735em1Axvi page
Mutation
origin
Strain of Origin:  FVB
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsCTCF-binding sequence downstream of Tbx5 lung enhancer Rr426, located downstream of the gene, was targeted with sgRNAs (targeting GCATGCTGGGGTAAGCCCGAGGG and GCTGGGGTGCCAAGCCCAGAGGG, GGTCAGAGTCTGCCGCCCAAAGG and AAGGCCTGAGAGCGCGCCAGTGG) using CRISPR/Cas9 technology, resulting in an 1135 bp deletion (chr5:120240528-120241662 (GRCm39)). (J:335096)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr108735 Mutation:  0 strains or lines available
References
Original:  J:335096 Rajderkar S, et al., Topologically associating domain boundaries are required for normal genome function. Commun Biol. 2023 Apr 20;6(1):435
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory