About   Help   FAQ
Rr52em1Axvi
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr52em1Axvi
Name: regulatory region 52; endonuclease-mediated mutation 1, Axel Visel
MGI ID: MGI:7489594
Synonyms: B7
Gene: Rr52  Location: Chr3:127763630-127798271 bp  Genetic Position: Chr3, Syntenic
Alliance: Rr52em1Axvi page
Mutation
origin
Strain of Origin:  FVB
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe topologically associating domain (TAD) boundary region or insulator between Fam241a and Pitx2, separating the Neurog2 TAD from the Pitx2 TAD, was targeted with sgRNAs (targeting TCACTACATCGAGTAGAACCCGG, GACATCAGTTGTAGAAAACACGG, ATCTCAAGTTAAGGGTCTGTGGG and CATCTCAAGTTAAGGGTCTGTGG) using CRISPR/Cas9 technology, resulting in a 34240 bp deletion (chr3:127763934-127798173 (GRCm39)). (J:335096)
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rr52 Mutation:  1 strain or line available
References
Original:  J:335096 Rajderkar S, et al., Topologically associating domain boundaries are required for normal genome function. Commun Biol. 2023 Apr 20;6(1):435
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory