Asxl1^em1Btp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Asxl1^em1Btp
• Name: ASXL transcriptional regulator 1; endonuclease-mediated mutation 1, Bo Torben Porse
• MGI ID: MGI:7488533
• Synonyms: Asxl1^G643W
• Gene: Asxl1 Location: Chr2:153187750-153245927 bp, + strand Genetic Position: Chr2, 75.41 cM
• Alliance: Asxl1^em1Btp page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Insertion
• Mutation details: An extra G nucleotide was inserted in exon 13 (ENSMUST00000109790:c.1925dupG) using two sgRNAs (targeting GGCCACCACTGCCATCGGAG and GTGGTAACCTCTCGCCCCTC) and ssODN template with CRISPR/Cas9 technology, resulting in a reading frame shift and premature stop codon shortly thereafter. This mutation is the equivalent of a human p.G643Wfs*12 mutation associated with acute myeloid leukemia (AML). (J:324868)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Asxl1 Mutation: 116 strains or lines available

References

• Original: J:324868 D'Altri T, et al., The ASXL1-G643W variant accelerates the development of CEBPA mutant acute myeloid leukemia. Haematologica. 2021 Apr 1;106(4):1000-1007
• All: 1 reference(s)