About   Help   FAQ
Asxl1em1Btp
Endonuclease-mediated Allele Detail
Summary
Symbol: Asxl1em1Btp
Name: ASXL transcriptional regulator 1; endonuclease-mediated mutation 1, Bo Torben Porse
MGI ID: MGI:7488533
Synonyms: Asxl1G643W
Gene: Asxl1  Location: Chr2:153187750-153245927 bp, + strand  Genetic Position: Chr2, 75.41 cM
Alliance: Asxl1em1Btp page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Insertion
 
Mutation detailsAn extra G nucleotide was inserted in exon 13 (ENSMUST00000109790:c.1925dupG) using two sgRNAs (targeting GGCCACCACTGCCATCGGAG and GTGGTAACCTCTCGCCCCTC) and ssODN template with CRISPR/Cas9 technology, resulting in a reading frame shift and premature stop codon shortly thereafter. This mutation is the equivalent of a human p.G643Wfs*12 mutation associated with acute myeloid leukemia (AML). (J:324868)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Asxl1 Mutation:  116 strains or lines available
References
Original:  J:324868 D'Altri T, et al., The ASXL1-G643W variant accelerates the development of CEBPA mutant acute myeloid leukemia. Haematologica. 2021 Apr 1;106(4):1000-1007
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory