Tmsb10^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmsb10^em1(IMPC)J
• Name: thymosin beta 10; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7485946
• Gene: Tmsb10 Location: Chr6:72934330-72935731 bp, - strand Genetic Position: Chr6, 32.35 cM
• Alliance: Tmsb10^em1(IMPC)J page
• IMPC: Tmsb10 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGGAGTGAGTTGTGCCGCA and TTAGGAACGCGGGCCGAGAA, which resulted in a 1282 bp deletion beginning at Chromosome 6 position 72,957,282 bp and ending after 72,958,563 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000697927 and ENSMUSE00000697926 (exons 1 and 2) and 592 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tmsb10 Mutation: 10 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)