Mdm2^1m1.1Dwg
Targeted Allele Detail

Summary

• Symbol: Mdm2^1m1.1Dwg
• Name: transformed mouse 3T3 cell double minute 2; targeted mutation 1.1, David W Goodrich
• MGI ID: MGI:7485930
• Synonyms: Mdm2^L466A, Mdm2^la
• Gene: Mdm2 Location: Chr10:117524780-117546663 bp, - strand Genetic Position: Chr10, 66.32 cM, cytoband C1-C3
• Alliance: Mdm2^1m1.1Dwg page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:325001
• Parent Cell Line: W4 (ES Cell)
• Strain of Origin: 129S6/SvEvTac

Mutation description

• Allele Type: Targeted (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Exons 10-12 were targeted with a modified BAC that contains an FRT site flanked neomycin resistance gene cassette in intron 9 and an exon 12 where leucine codon 466 (CTA) was changed to alanine (GCA) (p.L466A). Recombination was aided by CRISPR/Cas9 editing with an sgRNA (targeting GCATTGTTCACGGCAAGACTGG). The neo cassette was removed through subsequent Flp-mediated recombination. The mutation is the equivalent of the human p.L468A mutation that abolishes human MDM2 (HDM2)-mediated p53 multi-monoubiquitination and HDM2-MDM4 mediated p53 polyubiquitination. (J:325001)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mdm2 Mutation: 53 strains or lines available

References

• Original: J:325001 Chinnam M, et al., MDM2 E3 ligase activity is essential for p53 regulation and cell cycle integrity. PLoS Genet. 2022 May;18(5):e1010171
• All: 1 reference(s)