Cgas^em1Qiche
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cgas^em1Qiche
• Name: cyclic GMP-AMP synthase; endonuclease-mediated mutation 1, Qi Chen
• MGI ID: MGI:7485821
• Synonyms: cGas^-
• Gene: Cgas Location: Chr9:78337808-78350519 bp, - strand Genetic Position: Chr9, 43.65 cM
• Alliance: Cgas^em1Qiche page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 1 was targeted with an sgRNA (targeting CCTTACGACTTTCCGCGCCT) using CRISPR/Cas9 technology, resulting in a knock-out allele. (J:295560)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cgas Mutation: 23 strains or lines available

References

• Original: J:295560 Xiao N, et al., cGAS activation causes lupus-like autoimmune disorders in a TREX1 mutant mouse model. J Autoimmun. 2019 Jun;100:84-94
• All: 1 reference(s)