Trex1^em1Qiche
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trex1^em1Qiche
• Name: three prime repair exonuclease 1; endonuclease-mediated mutation 1, Qi Chen
• MGI ID: MGI:7485808
• Synonyms: Trex1^D18N
• Gene: Trex1 Location: Chr9:108887000-108888791 bp, - strand Genetic Position: Chr9, 59.63 cM
• Alliance: Trex1^em1Qiche page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Aspartic acid codon 18 (GAC) was changed to asparagine (AAT) (p.D18N) using an sgRNA (targeting CCACTGGCCTGCCTTCGTCT) and an ssODN template with CRISPR/Cas9 technology. The equivalent human mutation is associated with familial chilblain lupus (FCL). (J:295560)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Trex1 Mutation: 29 strains or lines available

References

• Original: J:295560 Xiao N, et al., cGAS activation causes lupus-like autoimmune disorders in a TREX1 mutant mouse model. J Autoimmun. 2019 Jun;100:84-94
• All: 2 reference(s)