Adar^em2Qwan
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adar^em2Qwan
• Name: adenosine deaminase, RNA-specific; endonuclease-mediated mutation 2, Qingde Wang
• MGI ID: MGI:7484719
• Synonyms: Adar^P193A
• Gene: Adar Location: Chr3:89622329-89660753 bp, + strand Genetic Position: Chr3, 39.19 cM, cytoband F2
• Alliance: Adar^em2Qwan page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Proline codon 195 was changed to alanine (c.583C>G p.P195A) using an sgRNA (targeting GCAAGGCAAGCTTCGCACCA) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.P193A mutation associated with Aicardi-Goutieres syndrome (AGS). (J:325221)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Adar Mutation: 71 strains or lines available

References

• Original: J:325221 Guo X, et al., Aicardi-Goutieres syndrome-associated mutation at ADAR1 gene locus activates innate immune response in mouse brain. J Neuroinflammation. 2021 Jul 31;18(1):169
• All: 1 reference(s)