Clp1^em2Schaf
Endonuclease-mediated Allele Detail

Summary

• Symbol: Clp1^em2Schaf
• Name: CLP1, cleavage and polyadenylation factor I subunit; endonuclease-mediated mutation 2, Ashleigh Schaffer
• MGI ID: MGI:7484675
• Synonyms: Clp1^KO
• Gene: Clp1 Location: Chr2:84553466-84557631 bp, - strand Genetic Position: Chr2, 49.45 cM
• Alliance: Clp1^em2Schaf page

Mutation origin

• Strain of Origin: (C57BL/6J x SJL/J)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Arginine codon 140 (CGT) in exon 2 was targeted for change to histidine (CAT) (c.419G>A p.R140H) using an sgRNA (targeting AACGCACTGCGTAGTTGAGT) and an ssODN template with CRISPR/Cas9 technology. This allele represents an incompletely repaired sequence with a 4 bp deletion around the intended mutation (c.417_420delGCGT) that introduces a frameshift and a premature stop codon shortly thereafter (p.R140Wfs*10) and is thus a knock-out allele. (J:325410)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Clp1 Mutation: 18 strains or lines available

References

• Original: J:325410 LaForce GR, et al., Suppression of premature transcription termination leads to reduced mRNA isoform diversity and neurodegeneration. Neuron. 2022 Apr 20;110(8):1340-1357.e7
• All: 1 reference(s)