Ret^em3Heno
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ret^em3Heno
• Name: ret proto-oncogene; endonuclease-mediated mutation 3, Hideki Enomoto
• MGI ID: MGI:7484391
• Synonyms: Ret^M919T
• Gene: Ret Location: Chr6:118128706-118174679 bp, - strand Genetic Position: Chr6, 55.86 cM, cytoband E3-F1
• Alliance: Ret^em3Heno page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Methionine codon 919 (ATG) was changed to threonine (ACC) (p.M919T) using an sgRNA (targeting CCGGATTCCCGTCAAGTGGATGG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.M918T mutation associated with multiple endocrine neoplasia type 2B (MEN2B). (J:325770)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ret Mutation: 52 strains or lines available

References

• Original: J:325770 Nakatani T, et al., Point mutagenesis in mouse reveals contrasting pathogenetic effects between MEN2B- and Hirschsprung disease-associated missense mutations of the RET gene. Dev Growth Differ. 2020 May;62(4):214-222
• All: 1 reference(s)