Retem4Heno
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Retem4Heno |
| Name: |
ret proto-oncogene; endonuclease-mediated mutation 4, Hideki Enomoto |
| MGI ID: |
MGI:7484389 |
| Synonyms: |
RetN396K |
| Gene: |
Ret Location: Chr6:118128706-118174679 bp, - strand Genetic Position: Chr6, 55.86 cM, cytoband E3-F1
|
| Alliance: |
Retem4Heno page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details: Asparagine codon 396 (AAC) was changed to lysine (AAG) (p.N396K) using an sgRNA (targeting CCATTTCAACGTGTCTGTACTG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.N394K mutation associated with Hirschsprung disease (HSCR).
(J:325770)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Ret Mutation: |
52 strains or lines available
|
|
| Original: |
J:325770 Nakatani T, et al., Point mutagenesis in mouse reveals contrasting pathogenetic effects between MEN2B- and Hirschsprung disease-associated missense mutations of the RET gene. Dev Growth Differ. 2020 May;62(4):214-222 |
| All: |
1 reference(s) |
|