Ret^em4Heno
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ret^em4Heno
• Name: ret proto-oncogene; endonuclease-mediated mutation 4, Hideki Enomoto
• MGI ID: MGI:7484389
• Synonyms: Ret^N396K
• Gene: Ret Location: Chr6:118128706-118174679 bp, - strand Genetic Position: Chr6, 55.86 cM, cytoband E3-F1
• Alliance: Ret^em4Heno page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Asparagine codon 396 (AAC) was changed to lysine (AAG) (p.N396K) using an sgRNA (targeting CCATTTCAACGTGTCTGTACTG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.N394K mutation associated with Hirschsprung disease (HSCR). (J:325770)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ret Mutation: 52 strains or lines available

References

• Original: J:325770 Nakatani T, et al., Point mutagenesis in mouse reveals contrasting pathogenetic effects between MEN2B- and Hirschsprung disease-associated missense mutations of the RET gene. Dev Growth Differ. 2020 May;62(4):214-222
• All: 1 reference(s)