Scn11a^em1Nju
Endonuclease-mediated Allele Detail

Summary

• Symbol: Scn11a^em1Nju
• Name: sodium channel, voltage-gated, type XI, alpha; endonuclease-mediated mutation 1, Model Animal Research Center of Nanjing University
• MGI ID: MGI:7484377
• Synonyms: Scn11a^R222S
• Gene: Scn11a Location: Chr9:119582829-119654522 bp, - strand Genetic Position: Chr9, 71.33 cM, cytoband F3-F4
• Alliance: Scn11a^em1Nju page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codon 222 (CGT) was changed to serine (AGC) (p.R222S) using an sgRNA (targeting CAGAGCTCTCAACACTCGGAAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.R222S mutation associated with familial episodic pain syndrome (FEPS). (J:325780)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Scn11a Mutation: 89 strains or lines available

References

• Original: J:325780 Zhao C, et al., The Gain-of-Function R222S Variant in Scn11a Contributes to Visceral Hyperalgesia and Intestinal Dysmotility in Scn11a (R222S/R222S) Mice. Front Neurol. 2022;13:856459
• All: 1 reference(s)