Cgas^em1Bge
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cgas^em1Bge
• Name: cyclic GMP-AMP synthase; endonuclease-mediated mutation 1, Baoxue Ge
• MGI ID: MGI:7484367
• Synonyms: Cgas^E176A
• Gene: Cgas Location: Chr9:78337808-78350519 bp, - strand Genetic Position: Chr9, 43.65 cM
• Alliance: Cgas^em1Bge page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Single point mutation
• Mutation details: Glutamic acid codon 176 (GAA) was changed to alanine (GCA) (p.E176A) using a sgRNA and an ssODN template (AAACGCAAAGATATCTCGGAGGCGGCCGAGACGGTGAATAAAGTTGTTGCACGCCTGCTGCGCAGAATGCAGAAACGGGAGTCGGAGTTCAAAGGT) with CRISPR/Cas9 technology. This mutation blocks PARylation (poly(ADP) ribosylation) of the residue in the encoded peptide. (J:325965)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cgas Mutation: 26 strains or lines available

References

• Original: J:325965 Wang F, et al., Cytoplasmic PARP1 links the genome instability to the inhibition of antiviral immunity through PARylating cGAS. Mol Cell. 2022 Jun 2;82(11):2032-2049.e7
• All: 1 reference(s)