About   Help   FAQ
Tenm1em2Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Tenm1em2Tcp
Name: teneurin transmembrane protein 1; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:7482185
Gene: Tenm1  Location: ChrX:41616743-42518003 bp, - strand  Genetic Position: ChrX, 23.21 cM, cytoband A2
Alliance: Tenm1em2Tcp page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CGGTACAGATCTATGGGCAA and TCATGGTAGATGTCACCATA targeting within ENSMUSE00000327545. This resulted in an 841bp deletion of ChrX from 41624774 to 41625614 with the insertion of T (GRCm39), introducing a frameshift and premature stop codon. (J:322048)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tenm1 Mutation:  19 strains or lines available
References
Original:  J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory