Tenm1^em2Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tenm1^em2Tcp
• Name: teneurin transmembrane protein 1; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:7482185
• Gene: Tenm1 Location: ChrX:41616743-42518003 bp, - strand Genetic Position: ChrX, 23.21 cM, cytoband A2
• Alliance: Tenm1^em2Tcp page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CGGTACAGATCTATGGGCAA and TCATGGTAGATGTCACCATA targeting within ENSMUSE00000327545. This resulted in an 841bp deletion of ChrX from 41624774 to 41625614 with the insertion of T (GRCm39), introducing a frameshift and premature stop codon. (J:322048)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tenm1 Mutation: 21 strains or lines available

References

• Original: J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022
• All: 1 reference(s)