About   Help   FAQ
Txnipem1Ngwu
Endonuclease-mediated Allele Detail
Summary
Symbol: Txnipem1Ngwu
Name: thioredoxin interacting protein; endonuclease-mediated mutation 1, Ning Wu
MGI ID: MGI:7482010
Synonyms: NTX
Gene: Txnip  Location: Chr3:96465273-96469173 bp, + strand  Genetic Position: Chr3, 41.93 cM, cytoband F2.2
Alliance: Txnipem1Ngwu page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Epitope tag)
Mutation:    Insertion
 
Mutation detailsCRISPR/cas9 endonuclease-mediated genome editing using crRNA/tracrRNA duplex gRNA (crRNA: GAACCCACUCGGCUCAAUCAGUUUUAGAGCUAUGCU, universal tracer RNA: AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU) is designed to insert an N-terminal double HA tag immediately downstream of the initial Met start codon with SerGlyGly as the linker peptide. (J:335573)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Txnip Mutation:  51 strains or lines available
References
Original:  J:335573 Waldhart AN, et al., Optimal HSF1 activation in response to acute cold stress in BAT requires nuclear TXNIP. iScience. 2023 May 19;26(5):106538
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory