Lrrc40em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Lrrc40em1(IMPC)J |
Name: |
leucine rich repeat containing 40; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7481915 |
Gene: |
Lrrc40 Location: Chr3:157742340-157772727 bp, + strand Genetic Position: Chr3, 81.65 cM, cytoband H4
|
Alliance: |
Lrrc40em1(IMPC)J page
|
IMPC: |
Lrrc40 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAATTTCTGGACAGCAGTT and GATGCTGTATTCTACCCAAG, which resulted in a 358 bp deletion beginning at Chromosome 3 position 158,041,427 bp and ending after 158,041,784 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000471787 (exon 3) and 284 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 111 and early truncation 1 amino acid later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|