Spag5^em1Svap
Endonuclease-mediated Allele Detail

Summary

• Symbol: Spag5^em1Svap
• Name: sperm associated antigen 5; endonuclease-mediated mutation 1, Svante Paabo
• MGI ID: MGI:7470781
• Synonyms: hSPAG5
• Gene: Spag5 Location: Chr11:78192412-78213283 bp, + strand Genetic Position: Chr11, 46.74 cM, cytoband B5
• Alliance: Spag5^em1Svap page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Proline codon 43 (CCC) was changed to serine (AGT) (p.P43S), glutamic acid codon 164 (GAA) to glycine (GGC) (p.E164G) and aspartic acid codon 380 (GAC) to histidine (CAC) (p.D380H) using sgRNAs (targeting GCACAGGTATGGGGTCAGCG, AAGCTCTCTAAATGAATCTT and AGGACAGTACTTCAGAGACA) and ssODN templates with CRISPR/Cas9 technology. These mutations change the mouse residues to the residues found in the orthologous human gene (S43, G162, H410). (J:327275)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Spag5 Mutation: 40 strains or lines available

References

• Original: J:327275 Mora-Bermudez F, et al., Longer metaphase and fewer chromosome segregation errors in modern human than Neanderthal brain development. Sci Adv. 2022 Jul 29;8(30):eabn7702
• All: 1 reference(s)