Knl1^em1Svap
Endonuclease-mediated Allele Detail

Summary

• Symbol: Knl1^em1Svap
• Name: kinetochore scaffold 1; endonuclease-mediated mutation 1, Svante Paabo
• MGI ID: MGI:7470780
• Synonyms: hKNL1
• Gene: Knl1 Location: Chr2:118877600-118935982 bp, + strand Genetic Position: Chr2, 59.85 cM, cytoband E5
• Alliance: Knl1^em1Svap page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Histidine codon 109 (CAT) was changed to arginine (CGC) (p.H109R) and glycine codon 910 (GGC) to serine (TCC) (p.G910S) using sgRNAs (targeting CATTTGCATGTTTCCTTTCA and TTTCTGAATGAACTTCTGTC) and ssODN templates with CRISPR/Cas9 technology. These mutations change the mouse residues to the residues found in the orthologous human gene (R159, S1086). (J:327275)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Knl1 Mutation: 102 strains or lines available

References

• Original: J:327275 Mora-Bermudez F, et al., Longer metaphase and fewer chromosome segregation errors in modern human than Neanderthal brain development. Sci Adv. 2022 Jul 29;8(30):eabn7702
• All: 1 reference(s)