Kif18a^em1Svap
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kif18a^em1Svap
• Name: kinesin family member 18A; endonuclease-mediated mutation 1, Svante Paabo
• MGI ID: MGI:7470779
• Synonyms: hKIF18a
• Gene: Kif18a Location: Chr2:109111165-109172094 bp, + strand Genetic Position: Chr2, 56.55 cM
• Alliance: Kif18a^em1Svap page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codon 67 (AGG) was changed to lysine (AAA) (p.R67K) using an sgRNA (targeting CAAATTTTGATATTACTAAA) and an ssODN template with CRISPR/Cas9 technology. This mutation changes the mouse residue to the residue found in the orthologous human gene. (J:327275)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Kif18a Mutation: 63 strains or lines available

References

• Original: J:327275 Mora-Bermudez F, et al., Longer metaphase and fewer chromosome segregation errors in modern human than Neanderthal brain development. Sci Adv. 2022 Jul 29;8(30):eabn7702
• All: 1 reference(s)