Exo1^em1Wed
Endonuclease-mediated Allele Detail

Summary

• Symbol: Exo1^em1Wed
• Name: exonuclease 1; endonuclease-mediated mutation 1, Winfried Edelmann
• MGI ID: MGI:7468985
• Synonyms: Exo1^A, EXO1^D173A, Exo1^DA
• Gene: Exo1 Location: Chr1:175708334-175738962 bp, + strand Genetic Position: Chr1, 81.9 cM
• Alliance: Exo1^em1Wed page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Hypomorph)
• Mutation: Single point mutation
• Mutation details: Aspartic acid codon 173 (GAC) was changed to alanine (GCC) (p.D173A) using an sgRNA (targeting GACTCTGACCTCCTCGCATTTGG) and an ssODN template with CRISPR/Cas9 technology. The highly conserved mutated residue is located in the exonuclease site. (J:327354)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Exo1 Mutation: 45 strains or lines available

References

• Original: J:327354 Wang S, et al., Role of EXO1 nuclease activity in genome maintenance, the immune response and tumor suppression in Exo1D173A mice. Nucleic Acids Res. 2022 Aug 12;50(14):8093-8106
• All: 3 reference(s)