About   Help   FAQ
Lrfn5em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Lrfn5em1(IMPC)Tcp
Name: leucine rich repeat and fibronectin type III domain containing 5; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:7467316
Gene: Lrfn5  Location: Chr12:61569936-61905128 bp, + strand  Genetic Position: Chr12, 26.43 cM
Alliance: Lrfn5em1(IMPC)Tcp page
IMPC: Lrfn5 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes / injecting Cas9 mRNA with single guide RNAs with spacer sequences AAGAACTGTGGAGCTACGGC and GTATTGCTTCCAATCCGGCA targeting within exon ENSMUSE00000614088. This resulted in a 919bp deletion of Chr12 from 61886383 to 61887301 (GRCm39) introducing a frameshift and premature stop codon. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Lrfn5 Mutation:  43 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory