Zfp524^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp524^em1(IMPC)J
• Name: zinc finger protein 524; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7466984
• Gene: Zfp524 Location: Chr7:5018142-5021487 bp, + strand Genetic Position: Chr7, 2.9 cM, cytoband A1
• Alliance: Zfp524^em1(IMPC)J page
• IMPC: Zfp524 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAGATACTGGGGTACACGG and CTAGGGAGATGTGTGAGATG, which resulted in a 1202 bp deletion beginning at Chromosome 7 position 5,017,385 bp and ending after 5,018,586 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000538365 (exon 2) and 151 bp of flanking intronic sequence including the splice acceptor start site and splice donor and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp524 Mutation: 32 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)