Dpy19l4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dpy19l4^em1(IMPC)J
• Name: dpy-19 like 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7466927
• Gene: Dpy19l4 Location: Chr4:11261315-11322137 bp, - strand Genetic Position: Chr4, 5.11 cM
• Alliance: Dpy19l4^em1(IMPC)J page
• IMPC: Dpy19l4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTACAGCAAGCGCTTAGAC and AAGAATACCCTACAAACAGC, which resulted in a 1497 bp deletion beginning at Chromosome 4 position 11,303,116 bp and ending after 11,304,612 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001291800, ENSMUSE00001305659, ENSMUSE00000385379 (exons 4, 5, 6) and 1138 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 83 and early truncation 84 amino acids later. 61 bp before the deletion site there is an indel with 2 bp insertion (AA) and 5 bp deletion (CTGCT). (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dpy19l4 Mutation: 52 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)